Review



human ngr  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    R&D Systems human ngr
    Human Ngr, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human ngr/product/R&D Systems
    Average 93 stars, based on 12 article reviews
    human ngr - by Bioz Stars, 2026-03
    93/100 stars

    Images



    Similar Products

    93
    R&D Systems human ngr
    Human Ngr, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human ngr/product/R&D Systems
    Average 93 stars, based on 1 article reviews
    human ngr - by Bioz Stars, 2026-03
    93/100 stars
      Buy from Supplier

    90
    Thermo Fisher taqman gene-specific expression assay: human rtn4r
    KEY RESOURCES TABLE
    Taqman Gene Specific Expression Assay: Human Rtn4r, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman gene-specific expression assay: human rtn4r/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    taqman gene-specific expression assay: human rtn4r - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Millipore mission ® shrna, human rtn4r
    KEY RESOURCES TABLE
    Mission ® Shrna, Human Rtn4r, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mission ® shrna, human rtn4r/product/Millipore
    Average 90 stars, based on 1 article reviews
    mission ® shrna, human rtn4r - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    89
    OriGene sirnas
    a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R <t>siRNAs</t> (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human <t>RTN4R</t> <t>(pRTN4R-Myc),</t> and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.
    Sirnas, supplied by OriGene, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirnas/product/OriGene
    Average 89 stars, based on 1 article reviews
    sirnas - by Bioz Stars, 2026-03
    89/100 stars
      Buy from Supplier

    92
    R&D Systems rabbit anti gata3
    a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R <t>siRNAs</t> (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human <t>RTN4R</t> <t>(pRTN4R-Myc),</t> and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.
    Rabbit Anti Gata3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti gata3/product/R&D Systems
    Average 92 stars, based on 1 article reviews
    rabbit anti gata3 - by Bioz Stars, 2026-03
    92/100 stars
      Buy from Supplier

    89
    OriGene human tagged orf
    a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R <t>siRNAs</t> (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human <t>RTN4R</t> <t>(pRTN4R-Myc),</t> and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.
    Human Tagged Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human tagged orf/product/OriGene
    Average 89 stars, based on 1 article reviews
    human tagged orf - by Bioz Stars, 2026-03
    89/100 stars
      Buy from Supplier

    93
    R&D Systems anti hnogor antibody
    a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R <t>siRNAs</t> (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human <t>RTN4R</t> <t>(pRTN4R-Myc),</t> and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.
    Anti Hnogor Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti hnogor antibody/product/R&D Systems
    Average 93 stars, based on 1 article reviews
    anti hnogor antibody - by Bioz Stars, 2026-03
    93/100 stars
      Buy from Supplier

    93
    R&D Systems hpa057444 rrid ab 2683443 goat anti hnogor rtn4r antibody r d systems af1208
    a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R <t>siRNAs</t> (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human <t>RTN4R</t> <t>(pRTN4R-Myc),</t> and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.
    Hpa057444 Rrid Ab 2683443 Goat Anti Hnogor Rtn4r Antibody R D Systems Af1208, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hpa057444 rrid ab 2683443 goat anti hnogor rtn4r antibody r d systems af1208/product/R&D Systems
    Average 93 stars, based on 1 article reviews
    hpa057444 rrid ab 2683443 goat anti hnogor rtn4r antibody r d systems af1208 - by Bioz Stars, 2026-03
    93/100 stars
      Buy from Supplier

    93
    R&D Systems goat polyclonal antibody against hngr1
    a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R <t>siRNAs</t> (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human <t>RTN4R</t> <t>(pRTN4R-Myc),</t> and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.
    Goat Polyclonal Antibody Against Hngr1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/goat polyclonal antibody against hngr1/product/R&D Systems
    Average 93 stars, based on 1 article reviews
    goat polyclonal antibody against hngr1 - by Bioz Stars, 2026-03
    93/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Targeting RTN4/NoGo-Receptor reduces levels of ALS protein ataxin-2

    doi: 10.1016/j.celrep.2022.111505

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: TaqMan gene-specific expression assay: human RTN4R , Thermo Fisher Scientific , Hs00368533_m1.

    Techniques: Recombinant, Luciferase, Expressing, Sequencing, Amplification, RNA Sequencing, shRNA

    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Targeting RTN4/NoGo-Receptor reduces levels of ALS protein ataxin-2

    doi: 10.1016/j.celrep.2022.111505

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: TaqMan gene-specific expression assay: human RTN4R , Thermo Fisher Scientific , Hs00368533_m1.

    Techniques: Recombinant, Luciferase, Expressing, Sequencing, Amplification, RNA Sequencing, shRNA

    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Targeting RTN4/NoGo-Receptor reduces levels of ALS protein ataxin-2

    doi: 10.1016/j.celrep.2022.111505

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ataxin-2 antibody Novus Cat# NBP1-90063; RRID:AB_11028587 Tuj1 antibody Biolegend Cat# 802001; RRID:AB_2564645 Actin antibody EMD Millipore Cat# MAB1501, RRID:AB_2223041 RTN4/NoGo-Receptor antibody Abcam Cat# ab184556 GAPDH antibody Sigma Aldrich Cat# G8795; RRID:AB_1078991 Goat anti-Rabbit HRP antibody Life Technologies Cat# 31462; RRID:AB_228338 Goat anti-mouse HRP antibody Thermo Fisher Scientific Cat# 62–6520; RRID:AB_2533947 MAP2 antibody Synaptic Systems Cat# 188004; RRID:AB_2138181 NeuN antibody EMD Millipore Cat# MAB377; RRID:AB_2298772 Chemicals, peptides, and recombinant proteins NEP1-40 peptide Tocris Cat# 1984 Critical commercial assays Nano-Glo HiBiT Lytic Detection System Promega Cat# N3050 ONE-GLO Luciferase Assay System Promega Cat# E6120 TaqMan gene-specific expression assay: human ATXN2 Thermo Fisher Scientific Hs00268077_m1 TaqMan gene-specific expression assay: human ACTB Thermo Fisher Scientific Hs01060665_g1 TaqMan gene-specific expression assay: human RTN4R Thermo Fisher Scientific Hs00368533_m1 TaqMan gene-specific expression assay: mouse ATXN2 Thermo Fisher Scientific Mm00485932_m1 TaqMan gene-specific expression assay: mouse GAPDH Thermo Fisher Scientific Mm99999915_g1 TaqMan gene-specific expression assay: mouse RTN4R Thermo Fisher Scientific Mm00452228_m1 Human ATXN2 siRNA Horizon Discovery Cat# L-011772-00 Non-targeting siRNA Horizon Discovery Cat# D-001810-10 Human RTN4R siRNA Horizon Discovery Cat# L-008075-00 Oligonucleotides Target-specific sgRNA sequence IDT AGCCTTACAACTGCTGTTGG Forward Primer for ATXN2 exon 25 amplification and sequencing IDT GCAATACTGGTGCTTGGCTAATATTTGGGG Reverse Primer for ATXN2 exon 25 amplification and sequencing IDT CACTCTTGTTACTTCTTTTGCTAGCTGATGTG Deposited data iNeuron RNA sequencing data GEO GEO: GSE200530 Experimental models: Cell lines HEK293T Cells ATCC Cat# CRL-321; RRID:CVCL_0063 SH-SY5Y ATCC Cat# CRL-226; RRID:CVCL_0019 Experimental models: Organisms/strains Time pregnant C57BL/6 Charles River Labs Cat# C57BL/6NCr; RRID:MGI:2159769 Rtn4r KO mouse line Provided by Dr. Stephen Strittmatter N/A Recombinant DNA Mission ® shRNA, mouse RTN4R Sigma Aldrich TRCN0000436683 Mission ® shRNA, human RTN4R Sigma Aldrich TRCN0000061558 Open in a separate window KEY RESOURCES TABLE.

    Techniques: Recombinant, Luciferase, Expressing, Sequencing, Amplification, RNA Sequencing Assay, shRNA

    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Targeting RTN4/NoGo-Receptor reduces levels of ALS protein ataxin-2

    doi: 10.1016/j.celrep.2022.111505

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Ataxin-2 antibody Novus Cat# NBP1-90063; RRID:AB_11028587 Tuj1 antibody Biolegend Cat# 802001; RRID:AB_2564645 Actin antibody EMD Millipore Cat# MAB1501, RRID:AB_2223041 RTN4/NoGo-Receptor antibody Abcam Cat# ab184556 GAPDH antibody Sigma Aldrich Cat# G8795; RRID:AB_1078991 Goat anti-Rabbit HRP antibody Life Technologies Cat# 31462; RRID:AB_228338 Goat anti-mouse HRP antibody Thermo Fisher Scientific Cat# 62–6520; RRID:AB_2533947 MAP2 antibody Synaptic Systems Cat# 188004; RRID:AB_2138181 NeuN antibody EMD Millipore Cat# MAB377; RRID:AB_2298772 Chemicals, peptides, and recombinant proteins NEP1-40 peptide Tocris Cat# 1984 Critical commercial assays Nano-Glo HiBiT Lytic Detection System Promega Cat# N3050 ONE-GLO Luciferase Assay System Promega Cat# E6120 TaqMan gene-specific expression assay: human ATXN2 Thermo Fisher Scientific Hs00268077_m1 TaqMan gene-specific expression assay: human ACTB Thermo Fisher Scientific Hs01060665_g1 TaqMan gene-specific expression assay: human RTN4R Thermo Fisher Scientific Hs00368533_m1 TaqMan gene-specific expression assay: mouse ATXN2 Thermo Fisher Scientific Mm00485932_m1 TaqMan gene-specific expression assay: mouse GAPDH Thermo Fisher Scientific Mm99999915_g1 TaqMan gene-specific expression assay: mouse RTN4R Thermo Fisher Scientific Mm00452228_m1 Human ATXN2 siRNA Horizon Discovery Cat# L-011772-00 Non-targeting siRNA Horizon Discovery Cat# D-001810-10 Human RTN4R siRNA Horizon Discovery Cat# L-008075-00 Oligonucleotides Target-specific sgRNA sequence IDT AGCCTTACAACTGCTGTTGG Forward Primer for ATXN2 exon 25 amplification and sequencing IDT GCAATACTGGTGCTTGGCTAATATTTGGGG Reverse Primer for ATXN2 exon 25 amplification and sequencing IDT CACTCTTGTTACTTCTTTTGCTAGCTGATGTG Deposited data iNeuron RNA sequencing data GEO GEO: GSE200530 Experimental models: Cell lines HEK293T Cells ATCC Cat# CRL-321; RRID:CVCL_0063 SH-SY5Y ATCC Cat# CRL-226; RRID:CVCL_0019 Experimental models: Organisms/strains Time pregnant C57BL/6 Charles River Labs Cat# C57BL/6NCr; RRID:MGI:2159769 Rtn4r KO mouse line Provided by Dr. Stephen Strittmatter N/A Recombinant DNA Mission ® shRNA, mouse RTN4R Sigma Aldrich TRCN0000436683 Mission ® shRNA, human RTN4R Sigma Aldrich TRCN0000061558 Open in a separate window KEY RESOURCES TABLE.

    Techniques: Recombinant, Luciferase, Expressing, Sequencing, Amplification, RNA Sequencing Assay, shRNA

    a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNAs (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human RTN4R (pRTN4R-Myc), and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: Environmental cues from neural crest derivatives act as metastatic triggers in an embryonic neuroblastoma model

    doi: 10.1038/s41467-022-30237-3

    Figure Lengend Snippet: a – c Kaplan–Meier analysis of overall survival probability according to RTN4R ( a ), APP ( b ) and GRIA2 ( c ) expression levels in Shi and Fischer’s published cohort (GEO: GSE62564; http://r2.amc.nl ; n = 498 samples). Raw and Bonferroni corrected p values are indicated on the graphs. d , e Representative pictures ( d ) and quantification of cell–cell cohesion rate ( e ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2) and treated with E8-cSG cm ( N = 5 independent experiments; n: number of aggregates analyzed per condition; two-sided Mann–Whitney U test; ctl vs E8-cSG cm : siScr: p < 0.0001, siRTN4Ra: p = 0.0272, siAPP: p = 0.0003, siGRIA2: p = 0.0001; comparison to E8-cSG cm /siScr: E8-cSG cm /siRTN4Ra: p < 0.0001, E8-cSG cm /siAPP: p = 0.1343, E8-cSG cm /siAPP: p = 0.8601). f , g Representative pictures ( f ) and quantification of cell–cell cohesion rate ( g ) of IGR-N91 cell aggregates transfected with a control (siSCR) or a RTN4R siRNAs (siRTN4Ra, siRTN4Rb) together or not with a vector encoding for human RTN4R (pRTN4R-Myc), and treated with 10 µg/mL rOLFM1 ( N = 3 independent experiments; n: number of aggregates analyzed per condition;; two-sided Mann–Whitney U test; ctl vs rOLFM1: siScr: p < 0.0001, siRTN4Ra: p = 0.2455; rOLFM1/siRTN4Ra pCtl vs pRTN4R-Myc: p < 0.0001). h Quantification of IGR-N91 cells migration properties in transwell assays using E8-cSG cm in the lower part of the device. Cells were transfected either with a control (siSCR) or a RTN4R siRNA (siRTN4Ra) or an APP siRNA (siAPP) or a GRIA2 siRNA (siGRIA2). Ratios over the number of migrating cells in the control condition (medium without any cultured tissue in the lower part) are shown ( N = 5 independent experiments, two-sided Mann–Whitney U test; comparison to siScr: siRTN4Ra: p = 0.0079, siAPP: p = 0.4206, siGRIA2: p = 0.0159). i , j Representative pictures ( i ) and quantification of cell-cell cohesion rate ( j ) of IGR-N91 cell aggregates treated with E8-cSG cm supplemented or not with 50 μg/mL RTN4R antibody (RTN4R Ab) ( N = 3 independent experiments; n: number of aggregates analyzed per condition; using two-sided unpaired t test with Welch’s correction; ctl vs E8-cSG cm : p < 0.0001, E8-cSG cm vs E8-cSG cm + RTN4R Ab: p < 0.0001). Error bars show SEM. Scale bar: 1 mm. Source data are provided as a Source Data file.

    Article Snippet: Control siRNA (siRNA scr) (siRNA Universal Negative Control #1 SIC001, Sigma-Aldrich), human RTN4Ra (NM_023004; SASI_Hs01_00129206, Sigma-Aldrich), RTN4Rb (NM_023004, SASI_Hs01_ 00229277, Sigma-Aldrich), APP (NM_000484, SASI_Hs01_00185800, Sigma-Aldrich), GRIA2 (NM_001083620, SASI_Hs01_00035395, Sigma-Aldrich). pRTN4R-Myc, human tagged ORF clone, was purchased from Origene (NM_023004; #RC204073). siRNAs were used at a concentration of 50 nM.

    Techniques: Expressing, Transfection, MANN-WHITNEY, Plasmid Preparation, Migration, Cell Culture